MS/MS Oligonucleotide Sequencing Using LC/Q-TOF with HILIC Chromatography
Aplikace | 2023 | Agilent TechnologiesInstrumentace
LC/TOF, LC/HRMS, LC/MS, LC/MS/MS
ZaměřeníFarmaceutická analýza
VýrobceAgilent Technologies
Klíčová slovacharge, counts, ribose, oligonucleotides, mass, collision, hilic, acquisition, fragments, oligo, sequence, multiple, spectrum, oligonucleotide, energies, aptamer, time, aso, fluoro, coverage, were, energy, synthetic, states, min, using, state, higher, ion, cagtcgatagcagtcgatag, cagtcgatagcagtcgatagcagtcgatag, rcrargrurcrgrarururgrurarcrurgrurarcrurura, pairing, gas, code, abundant, guannan, simplified, charged, schema, sheath, temperature, fragmentation, criteria, fragmenting, tof, confirmation, retention, phosphorothioate, polarity
Podobná PDF
Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF
2023|Agilent Technologies|Aplikace
Application Note Pharma & Biopharma Oligonucleotides Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF Oligonucleotide identity, impurities analysis and sequence determination using BioConfirm 12.0 target plus impurities (TPI) and sequence confirmation workflows Authors Introduction Bian…
Klíčová slova
oligonucleotide, oligonucleotideaso, asosequence, sequencetpi, tpicounts, countsacquisition, acquisitionconfirmation, confirmationoligonucleotides, oligonucleotidesworkflow, workflowcharge, chargeimpurities, impuritiesbioconfirm, bioconfirmmass, massagilent, agilentfluoro
High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry
2022|Agilent Technologies|Aplikace
Application Note High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry Author Abstract Peter Rye, PhD Agilent Technologies, Inc. This application note describes a high-throughput, ion-pairing-free method for oligonucleotide characterization using the Agilent RapidFire…
Klíčová slova
oligo, oligorapidfire, rapidfirecounts, countshilic, hilicoligos, oligosdeconvoluted, deconvolutedcharge, chargeamu, amumass, massiprp, iprpdepurination, depurinationpredominant, predominantwere, weredeconvolution, deconvolutionheights
MS1 Oligonucleotide Characterization Using LC/Q‑TOF with HILIC Chromatography
2023|Agilent Technologies|Aplikace
Application Note BioPharma MS1 Oligonucleotide Characterization Using LC/Q-TOF with HILIC Chromatography Authors Introduction Peter Rye and Cody Schwarzer Agilent Technologies, Inc. The synthesis of RNA and DNA oligonucleotides (oligos) is an iterative process that, despite highly optimized chemistry, results in…
Klíčová slova
counts, countssirna, sirnadeconvoluted, deconvolutedoligos, oligosamu, amumass, masscharge, chargeoligo, oligohilic, hilicribose, riboseimpurities, impuritiesduplex, duplexwide, widedepur, depurtime
Comprehensive and Integrated Workflow for Oligonucleotide Sequence Confirmation by Agilent High-Resolution LC/Q-TOF
2022|Agilent Technologies|Aplikace
Application Note Biopharma/Pharma Comprehensive and Integrated Workflow for Oligonucleotide Sequence Confirmation by Agilent High-Resolution LC/Q-TOF Robust and sensitive sequence confirmation of synthetic oligonucleotides and impurities Authors David L. Wong and Peter Rye Agilent Technologies, Inc. Abstract This application note demonstrates…
Klíčová slova
oligonucleotide, oligonucleotidesequence, sequenceoligonucleotides, oligonucleotidesconfirmation, confirmationcounts, countscharge, chargemass, massfragment, fragmentworkflow, workflowrna, rnaimpurities, impuritiessequences, sequencesladder, ladderdata, dataacquisition